Phân lập và nhận diện dòng vi khuẩn chịu nhiệt cao có khả năng phân hủy lông gia súc, gia cầm

Nghiên cứu được thực hiện nhằm phân lập và tuyển chọn những dòng vi khuẩn chịu nhiệt có khả năng phân hủy mạnh các cơ chất chứa keratin từ lông gia súc-gia cầm. Có 54 dòng vi khuẩn hiếu khí chịu nhiệt đã được phân lập từ 18 mẫu đất và hai mẫu nước thu được tại các lò giết mổ ở ba tỉnh Cần Thơ, Vĩnh Long và Kiên Giang. Với 54 dòng có khả năng phát triển và phân hủy keratin ở 45oC; 18 dòng phát triển ở 50oC; 5 dòng phát triển ở 55oC. Các mẫu được pha loãng và nuôi cấy trên môi trường bột lông vũ để phân lập và khảo sát khả năng phân hủy cơ chất chứa keratin của vi khuẩn. Đa số các dòng vi khuẩn được phân lập có khuẩn lạc màu trắng đục hoặc vàng nhạt, bìa nguyên với 23 dòng tế bào hình que và 31 dòng hình cầu (42 dòng Gram âm và 12 dòng Gram dương). Trong đó dòng KG2 thể hiện khả năng phân hủy keratin mạnh nhất ở 55 oC với kết quả phân hủy lông gia cầm là 57,91%; kết quả phân hủy lông gia súc là 35,06%. Kết quả xác định trình tự đoạn gen 16S ribosomal RNA cho thấy dòng KG2 đồng hình 97% với dòng Bacillus megaterium AIMST 3.Ei.1.

1 GIỚI THIỆU
Ngành chăn nuôi ở Đồng Bằng Sông Cửu Long ngày càng phát triển, song song với những lợi nhuận là vấn đề ô nhiễm môi trường nghiêm trọng từ các sản phẩm chăn nuôi. Lông gia súc, gia cầm từ các lò giết mổ rất khó xử lý gây ảnh hưởng đến sức khỏe người dân sống xung quanh. Lông gia súc, gia cầm chứa đến 90% là protein (Onifade et al., 1998). Keratin là protein có cấu trúc dạng sợi, thành phần chủ yếu cấu tạo nên biểu bì, tóc, móng, lông, sừng,.. Một số phương pháp khác nhau đã được sử dụng cho xử lý rác thải lông, bao gồm cả chôn lấp, đốt, sản xuất khí đốt tự nhiên hay chế biến thành thức ăn bổ sung protein cho gia súc, gia cầm. Tuy nhiên, việc xử lý bằng phương pháp vật lý và hóa học hiện nay tiêu tốn nhiều năng lượng, gây ô nhiễm môi trường và phá hủy một số amino acid, làm giảm giá trị dinh dưỡng của sản phẩm (Wang and Parsons, 1997). Tuy nhiên một số loài vi khuẩn vẫn có khả năng phân giải keratin hiệu quả nhờ vào hoạt tính của enzyme keratinase (Onifade et al.,1998). Nhiều dòng vi khuẩn phân hủy keratin được phân lập từ đất và nước thải. Trong đó, Bacillus licheniformis PWD1 (Williams et al., 1990; Lin et al., 1995). Một số dòng ưa ấm (mesophilic) cũng được mô tả cho thấy khả năng phân giải keratin như Streptomyces pactum DSM 40530 (Bockle et al., 1995). Các dòng vi khuẩn Gram âm cũng có khả năng phân hủy keratin. Trong đó có hyseobacterium indologenes có khả năng phân hủy lông vũ trong quá trình nuôi cấy (Tam et al., 2014). Keratinase là một loại enzyme ngoại bào, chỉ được tạo ra trong sự hiện diện của keratin trong cơ chất. Keratinase chủ yếu tấn công vào các liên kết disulfide (S-S) của keratin (Bockle et al., 1995). Keratinase từ vi khuẩn có ứng dụng quang trọng trong các quy trình sinh học liên quan đến chất thải chứa keratin từ ngành chăn nuôi và chế biến gia cầm. Keratin lông không hòa tan có thể được chuyển đổi sau khi thủy phân bằng keratinase tạo phân bón, chất keo, thức ăn gia súc hay được sử dụng cho sản xuất của các amino acid hiếm như serine, systeine và proline (Onifade et al.,1998; Gupta and Ramnani, 2006). Theo báo cáo của Riffel et al. (2003) enzyme keratinase ly trích từ chủng Chyseobacterium có nhiệt độ tối ưu dưới 50oC. Trong khi chủng Bacillus subtillis với nhiệt độ 40oC và pH = 5-9 nuôi cấy trên môi trường bột lông, thì enzyme keratinase có hoạt tính cao 161U/ml (Kim et al., 2001). Theo báo cáo của Quách Thị Thanh Tâm và Bùi Thị Minh Diệu (2015) dòng Kr42 cho hoạt tính enzyme keratinase cao nhất 114 U/ml sau hai ngày nuôi cấy trên môi trường bột lông vũ ở 37oC. Hướng xử lý mới cho nguồn chất thải này là sử dụng các dòng vi khuẩn có khả năng sinh keratinase có hoạt tính cao. Tuy nhiên, trong quá trình xử lý, nhiệt độ trong quá trình phân hủy có thể tăng cao gây ức chế hoạt động của các dòng vi khuẩn phân hủy nguồn chất thải này. Chính vì vậy nghiên cứu này được thực hiện nhằm bổ sung một số vi sinh vật có ích làm tiền đề cho việc sản xuất chế phẩm sinh học xử lý chất thải lông gia súc, gia cầm và enzyme từ các chủng vi sinh vật này còn có tiềm năng được sử dụng trong công nghệ làm chất tẩy rửa, thuộc da.
2 VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU
2.1 Vật liệu
Hai mẫu nước (1 mẫu từ lò giết mổ Châu Thành, Kiên Giang, 1 mẫu từ lò giết mổ thành phố Rạch Giá- Kiên giang) và 18 mẫu đất được thu tại 18 cơ sở giết mổ gia súc, gia cầm thuộc các huyện Tam Bình (tỉnh Vĩnh Long), huyện Châu Thành, U Minh Thượng, Hòn Đất, Gò Quao, Rạch Giá (tỉnh Kiên Giang) và Quận Ô Môn (thành phố Cần Thơ). Mỗi
địa điểm thu 1 mẫu đất cho vào bọc nylon sạch, ghi nhãn đem về phòng thí nghiệm giữ ở nơi mát đến khi phân lập.
Cách thu mẫu:
– Với mẫu đất: đất được đào sâu khoảng 20 cm ở ngay cơ sở giết mổ gia súc-gia cầm, thu khoảng 10 gram mẫu.
– Với mẫu nước: thu tại nơi trực tiếp thải nguồn nước ra và thu khoảng 50 mL nước vào buổi sáng.
Nhận diện các dòng vi khuẩn được phân lập bằng phương pháp sinh học phân tử: DNA của vi khuẩn được ly trích và khuếch đại bằng phản ứng PCR với cặp mồi 27F và 1492R. Phản ứng khuyếch đại được tiến hành ở 95 oC trong 5 phút, sau đó lặp lại 30 chu
kỳ với các bước sau: biến tính ở 95 oC trong 30 giây, bắt cặp mồi vào khuôn ở 60 oC trong 30 giây, kéo dài ở 72 oC trong 1 phút, sau cùng phản ứng được duy trì ở 72 oC trong 10 phút (Yang et al., 2008).
2.2 Phương pháp nghiên cứu
2.2.1 Phân lập
Cân 1g mẫu đối với mẫu đất hoặc hút 10mL đối với mẫu nước cho vào bình tam giác 250 mL chứa 99mL (90mL đối với mẫu nước) môi trường có bổ sung bột lông vũ đã được khử trùng (Veslava et al., 2009) ủ ở 45oC trên máy lắc (120 rpm) trong vòng 36 giờ nhằm tăng sinh khối các vi khuẩn cần phân lập trong mẫu. Tiến hành pha loãng từ nồng độ 100 đến 10-10 . Chọn các nồng độ từ 10-6 đến 10-8 trải lên môi trường bột lông vũ ủ ở 45ºC trong 24 giờ.
Các khuẩn lạc có hình dạng khác nhau được chọn để cấy chuyển sang môi trường bột lông vũ và tiếp tục ủ ở 45ºC trong 24 giờ. Sau đó các khuẩn lạc này sẽ được tách ròng bằng phương pháp ria cấy cho đến khi thu được những khuẩn lạc ròng (khuẩn lạc rời,
có kích thước, màu sắc giống nhau (Cao Ngọc Điệp và Nguyễn Hữu Hiệp, 2008). Khảo sát khả năng chịu nhiệt của các dòng vi khuẩn bằng cách cấy các khuẩn lạc đã ròng sang môi trường bột lông và ủ lần lượt ở nhiệt độ 50oC. Các dòng vi khuẩn sống sót ở nhiệt độ 50oC sẽ được cấy sang môi trường bột lông và tiếp tục ủ ở nhiệt độ 55oC; tương tự các dòng sẽ được cấy chuyển và ủ ở nhiệt độ 60oC và theo dõi sự phát triển của chúng trong vòng 24 – 48h (Niamsup et al., 2003). Các đặc điểm của khuẩn lạc và tế bào của vi khuẩn được tiến hành quan sát về hình dạng, màu sắc, độ nổi, kích thước tế bào, đặc tính Gram (Cao Ngọc Điệp và Nguyễn Hữu Hiệp, 2008).
2.2.2 Đánh giá khả năng phân hủy lông gia súc – gia cầm của các dòng vi khuẩn ở 50oC
Đánh giá khả năng phân hủy lông gia cầm của các dòng vi khuẩn ở 50oC: từng dòng vi khuẩn đã phân lập phát triển ở 50oC được nuôi trong môi trường tăng sinh khối (môi trường có bổ sung bột lông vũ như trên nhưng không chứa agar) đến khi đạt mật số khoảng 1011 tế bào/mL. Hút 4 mL dịch vi khuẩn cho vào bình tam giác chứa 96 mL môi
trường như trên và lắc 120 vòng/phút ở 50oC trong 7 ngày. Một bình tam giác cùng với thể tích môi trường như trên nhưng không chủng vi khuẩn mà thay bằng 4 ml nước cất vô trùng được sử dụng làm mẫu đối chứng (Hoben and Somasegaran, 1982). Sau một tuần nuôi lắc, tiến hành lọc môi trường qua giấy lọc Whatman No.1 đã được cân khối lượng trước đó, cân lượng bột lông còn lại sau khi đã sấy khô ở 60oC để tính khối lượng bột lông đã bị phân hủy trong quá trình nuôi cấy (Nguyễn Huy Hoàng và ctv., 2010; Tam et al., 2014). Đánh giá khả năng phân hủy lông gia súc của các dòng vi khuẩn ở 50oC: thí nghiệm được tiến hành tương tự như trên nhưng lông gia cầm được thay bằng lông gia súc.
2.2.3 Đánh giá khả năng phân hủy lông gia súc – gia cầm của các dòng vi khuẩn ở 55oC
Đánh giá khả năng phân hủy lông gia súc – gia cầm của các dòng vi khuẩn ở 55oC: thí nghiệm được tiến hành tương tự như trên nhưng thay đổi nhiệt độ.
2.2.4 Nhận diện dòng vi khuẩn chịu nhiệt bằng phương pháp sinh học phân tử
Một dòng vi khuẩn chịu nhiệt và có khả năng phân hủy lông gia súc-gia cầm mạnh nhất được tuyển chọn giải trình tự đoạn gen 16S rRNA, đối chiếu với dữ liệu trên Genbank bằng công cụ BLAST để xác định mức độ tương đồng về trình tự của đoạn gen này với các dòng vi khuẩn đã được công bố. Quy trình được thực hiện như sau: ly trích DNA của vi khuẩn; kiểm tra độ tinh sạch của DNA bằng phương pháp đo quang phổ hấp thụ OD; thực hiện phản ứng PCR với cặp mồi 27F và 1492R dùng để khuếch đại đoạn gen 16S rRNA của vi khuẩn (Yang et al., 2008) có trình tự sau:
Mồi xuôi 8F: 5’ – AGAGTTTGATCCTGGCTCAG – 3’
Mồi ngược 1391R: 5′ – GACGGGCRGTGWGTRCA – 3’
Kiểm tra kích thước sản phẩm PCR bằng phương pháp điện di gel agarose 1.5% có nhuộm Ethidium bromide ở hiệu điện thế 80V trong 50 phút với thang chuẩn 100 bp. Sản phẩm từ phản ứng PCR được giải trình tự tại phòng thí nghiệm Sinh học Phân tử, Viện nghiên cứu và Phát triển Công nghệ Sinh học, Trường Đại học Cần Thơ.
2.2.5 Phân tích kết quả và xử lý thống kê
Tất cả số liệu thu được trong đề tài được phân tích thống kê ANOVA (analysis of variance) bằng phần mềm MS Excel. Giá trị trung bình được kiểm tra thống kê khác biệt có ý nghĩa LSDT (least significant difference test) bằng phần mềm Statgraphic Plus version 3.0.
3 KẾT QUẢ VÀ THẢO LUẬN
3.1 Kết quả phân lập vi khuẩn

Từ 20 mẫu (18 mẫu đất và hai mẫu nước) được thu được tại 18 cơ sở giết mổ gia súc – gia cầm ở các tỉnh Vĩnh long, Kiên Giang và thành phố Cần Thơ đã phân lập được 54 dòng vi khuẩn hiếu khí phát triển được ở 45oC; 18 dòng phát triển ở 50oC; 5 dòng phát triển ở 55oC là KG2, KG23, KG22, KG26, VL2. Tất cả các dòng vi khuẩn đều có khả
năng phát triển trên môi trường bột lông vũ, chứngtỏ khả năng sử dụng bột lông vũ như nguồn carbon và nitơ duy nhất cho sự phát triển (Daniel et al., 2009). Sau khi phân lập ròng, các dòng vi khuẩn được cấy trên môi trường đặc có cùng thành phần để quan sát hình thái khuẩn lạc. Thời gian trung bình để tế bào vi khuẩn phát triển thành khuẩn lạc trên môi trường phân lập từ 24-48h. Đặc điểm về hình thái khuẩn lạc của các dòng vi khuẩn được mô tả trong Bảng 1.


Trong 54 dòng vi khuẩn chịu nhiệt phân lập được có 23 dòng có dạng hình que, kích thước của các dòng dao động với chiều dài từ 0,57 μm đến 5,82 μm; 31 dòng vi khuẩn có dạng hình cầu, kích thước của các dòng dao động từ 0,68 μm đến 1,35 μm. Một số dòng vi khuẩn được phân lập có hình thái và kích thước thể hiện ở Bảng 2.

3.2 Khả năng phân hủy lông gia súc – gia cầm của các dòng vi khuẩn
Sau bảy ngày chủng lắc ở 2 mức nhiệt độ 50oC; 55 oC thì kết quả cho thấy các dòng vi khuẩn phân lập được đều có khả năng phân hủy keratin qua việc phân hủy bột lông gia súc – gia cầm, khác biệt ý nghĩa ở mức 5% so với nghiệm thức đối chứng (không chủng vi khuẩn). Trong đó dòng KG2 thể hiện khả năng phân hủy lông mạnh hơn so với các dòng KG22, KG23, KG26 và VL2 ở 55oC với kết quả phân hủy lông gia súc, gia cầm lần lượt là 35,06%; 57,91%. Kết quả này cao hơn kết quả của các dòng vi khuẩn được phân lập từ đất và nước tại trại chăn nuôi gia súc-gia cầm trong nghiên cứu của Quách Thị Thanh Tâm và ctv. (2014) cho hiệu quả phân hủy 26,75-27,75% sau 7 ngày ủ lắc ở 55oC. Tuy nhiên kết quả này thấp hơn kết quả của các dòng vi khuẩn được phân lập từ đất và lông vũ trong nghiên cứu của Nguyễn Huy Hoàng và ctv. (2010) cho hiệu quả phân hủy từ 52,40% đến 98,45% sau 7 ngày ủ lắc ở 30oC. Thành phần môi trường và nhiệt độ là hai yếu tố ảnh hưởng đáng kể đến sự tổng hợp enzyme keratinase của vi khuẩn. Sự tối ưu hóa hai yếu tố này có thể giúp nâng cao hiệu quả tổng hợp keratinase lên đến 40 lần (Brandelli, 2008). Vì vậy cần xác định nhiệt độ tối ưu của enzyme keratinase của mỗi dòng vi khuẩn phân lập.
3.2.1 Khả năng phân hủy lông gia súc của các dòng vi khuẩn
a. Khả năng phân hủy lông gia súc của các dòng vi khuẩn ở 50oC
Kết quả từ Bảng 3 và Hình 2 cho thấy dòng VL2 cho kết quả phân hủy bột lông gia súc mạnh hơn các dòng vi khuẩn còn lại với kết quả phân hủy là 53,73% (khác biệt có ý nghĩa thống kê ở mức 5% so với các dòng còn lại trong nhóm). Kết quả này cao hơn kết quả của dòng Kr11 với hiệu quả phân hủy lông gia súc đạt 37,66% sau 7 ngày ủ lắc ở 37 oC (Quách Thị Thanh Tâm và Bùi Thị Minh Diệu,2015). Các dòng vi khuẩn còn lại cũng có khả năng phân hủy bột lông gia súc tương đối tốt như KG2, KG30, CT5, KG22, KG23, trong đó thấp nhất là dòng KG26 với khả năng phân hủy 24,56%. Kết quả này cho thấy khả năng phân hủy lông gia súc-gia cầm của các dòng vi khuẩn chịu sự ảnh hưởng của nhiệt độ. Ở nhiệt độ 50oC thì dòng VL2 vi khuẩn phân hủy lông hiệu quả hơn dòng Kr11 ở 37oC. Theo nghiên cứu của Cao et al. (2008) enzyme keratinase có hoạt tính tối ưu ở pH là 7.8 và nhiệt độ là 40 oC. Điều đó, chứng tỏ khả năng phân hủy lông chịu ảnh hưởng của nhiệt độ tối ưu và pH tối ưu của enzyme keratinase.

Hình 2: Khả năng phân hủy bột lông gia súc của 18 dòng vi khuẩn sau một tuần nuôi lắc ở 50oC

b. Khả năng phân hủy lông gia súc của các dòng vi khuẩn ở 55oC
Kết quả từ Bảng 4 cho thấy nhóm vi khuẩn khảo sát ở 55oC cũng cho kết quả phân hủy bột lông gia súc khá tốt. Trong đó dòng VL2 phân hủy lông gia súc cao nhất trong 5 dòng được khảo sát so với các dòng còn lại. Ngoài ra, dòng KG22, KG2 cũng có khả năng phân hủy tương đối lần lượt là 37,38% và 35,06%. Dòng KG26 có kết quả phân hủy thấp nhất 20,77%.

3.2.2 Khả năng phân hủy lông gia cầm của các dòng vi khuẩn
a.Khả năng phân hủy lông gia cầm của các dòng vi khuẩn ở 50oC
Kết quả từ Bảng 5 và Hình 3 cho thấy một số lượng đáng kể bột lông gia cầm đã bị phân hủy bởicác dòng vi khuẩn phân lập được và đã hòa tan vào dung dịch. Dòng VL12 cho khả năng phân hủy tốt nhất trong các dòng phân lập được với 72,97% lượng bột lông bị phân hủy sau 7 ngày nuôi lắc. Ngoài ra, dòng KG30, KG2, VL8, KG1 có tỷ lệ phân hủy cũng tương đối cao lần lượt là 71,11%; 67,39%; 67,33% và 67,28%.
Kết quả thí nghiệm thu được cao hơn nhiều so với kết quả nghiên cứu của Nguyễn Đình Quyến và Trần Thị Lan Phương (2001) cho thấy hai dòng vi khuẩn B7 và B15 (phân lập từ đất) chỉ phân hủy được 14,4% lông gà sau năm ngày ủ ở 37oC. Tuy nhiên, kết quả này hơi thấp hơn tỷ lệ phân hủy lông so với ngiên cứu của Daniel et al. (2009) đã phân
lập dòng vi khuẩn Bacillus phân hủy 90% lông sau 72 giờ nuôi cấy trong môi trường lỏng chỉ toàn bột lông ở 30oC, và các dòng vi khuẩn được phân lập từ đất và lông vũ của Nguyễn Huy Hoàng và ctv. (2010) cho hiệu quả phân hủy đến 98,45% sau một tuần lắc ủ ở 30oC. Nhưng nghiên cứu này khảo sát khả năng phân hủy lông ở nhiệt độ 50oC.

Hình 3: Khả năng phân hủy bột lông gia cầm của 18 dòng vi khuẩn sau một tuần nuôi lắc ở 50oC

c. Khả năng phân hủy lông gia cầm của các dòng vi khuẩn ở 55oC
Kết quả từ Bảng 6 cho thấy khối lượng của bột lông gia cầm giảm từ 37,12% đến 57,91 %. Dòng KG2 và VL2 có khả năng phân hủy mạnh hơn so với các dòng còn lại, tỷ lệ phân hủy lần lượt là 57,91% và 54,87%. Dòng KG26 có kết quả phân hủy thấp nhất 37,12%.

Kết quả khảo sát khả năng phân hủy lông gia súc-gia cầm của các dòng vi khuẩn cho thấy khả năng phân hủy lông gia cầm cho hiệu quả cao hơn khả năng phân hủy lông gia súc (Hình 4) hầu như ở tất cả các dòng vi khuẩn tương ứng, mặc dù chúng được phân lập từ các lò giết mổ gia súc-gia cầm. Đều này cho thấy khả năng phân hủy cơ chất chứa keratin không chỉ phụ thuộc vào dòng vi khuẩn và hoạt độ enzyme keratinase do chúng tạo ra, mà còn phụ thuộc vào cấu trúc của keratin chứ không bị ảnh hưởng nhiều từ nguồn phân lập. Sự khác biệt khả năng phân hủy lông gia súc và gia cầm của các dòng vi khuẩn cũng có thể là do sự khác biệt về cấu trúc keratin giữa lông gia súc  -keratin và lông gia cầm  -keratin cũng như hàm lượng sulfur trong hai loại cơ chất này (Akhtar and Edwards, 1997).

Hình 4: Khả năng phân hủy bột lông gia súc, gia cầm của các dòng vi khuẩn sau 7 ngày lắc ủ ở 55oC

Ghi chú: Số liệu thống kê trên là giá trị trung bình của 3 lần lặp lại
3.3 Nhận diện một số dòng vi khuẩn chịu nhiệt bằng phương pháp sinh học phân tử

Dựa vào kết quả khảo sát khả năng phân hủy keratin qua việc khảo sát kết quả phân hủy bột lông gia súc-gia cầm. Đồng thời dựa vào khả năng chịu nhiệt của các dòng vi khuẩn phân lập được thì dòng KG2 được chọn để tiến hành nhận diện bằng phương pháp sinh học phân tử. DNA của dòng vi khuẩn được ly trích và khuếch đại bằng phản ứng PCR với cặp mồi 27F và 1492R. Kết quả điện di sản phẩm PCR của dòng vi khuẩn KG2 cho thấy đã khuếch đại thành công đoạn gene với kích thước khoảng 1.500bp (Hình 5).

Khi so sánh với dữ liệu ngân hàng gen trên trang web http://www.ncbi.nlm.nih.gov bằng chương trình BLAST, kết quả tra cứu cho thấy trình tự gen của dòng KG2 có kết quả tương đồng với dòng Bacillus megaterium AIMST 3.Ei.1 với độ tương đồng 97%.
Như vậy, dòng vi khuẩn được tuyển chọn từ nghiên cứu này thuộc chi Bacillus. Kết quả này phù hợp với kết luận của Ghosh et al., (2007) là phần lớn các dòng vi khuẩn có hoạt tính phân hủy keratin cao phân lập đều thuộc chi Bacillus. Các dòng vi khuẩn thuộc chi Bacillus đã được nghiên cứu khá nhiều và chứng tỏ được khả năng phân hủy cơ chất keratin. Dòng Bacillus megaterium F7-1 đã được Geun and Hong (2009) nghiên cứu và cho thấy khả năng phân hủy đến 26% lượng bột lông gà sau 24 giờ chủng ở 30°C.
4 KẾT LUẬN
Trong nghiên cứu này, từ 20 mẫu đất và nước thu tại 3 tỉnh Vĩnh Long, Kiên Giang và thành phố Cần Thơ đã phân lập được 54 dòng vi khuẩn có khả năng phát triển trên môi trường bột lông vũ. Phần lớn các dòng vi khuẩn có khuẩn lạc tròn, màu trắng trong, độ nổi mô và bìa nguyên, kích thước khuẩn lạc dao động từ 0,5 mm đến 6 mm. Trong 54 dòng vi khuẩn chịu nhiệt phân lập có 23 dòng có dạng hình que, kích thước của các dòng dao động với chiều dài từ 0,57 μm đến 5,82 μm; 31 dòng vi khuẩn có dạng hình cầu, kích thước của các dòng dao động từ 0,68 μm đến 1,35 μm. Tất cả 54 dòng vi khuẩn đều phát triển ở nhiệt độ 45°C. Trong đó, có 18 dòng có thể tồn tại ở 50°C, 5 dòng có thể tồn tại ở 55°C. Sau đó khảo sát sự phân hủy lông cho thấy các dòng vi khuẩn phân hủy bột lông gia cầm từ 37,12% đến 72,97%; phân hủy bột lông gia súc từ 20,77% đến 53,73% sau 7 ngày lắc ủ ở các mức nhiệt độ khảo sát từ 50°C đến 55°C. Dòng vi khuẩn KG2 cho thấy khả năng phân hủy lông gia súc-gia cầm mạnh hơn các dòng còn lại và có khả năng chịu được nhiệt độ cao. Kết quả định danh cho thấy dòng KG2 có kết quả tương đồng với dòng Bacillus megaterium AIMST 3.Ei.1 với độ tương đồng 97%.

Huỳnh Kim Yến và Bùi Thị Minh Diệu

Tạp chí Khoa học Trường Đại học Cần Thơ Tập 54, Số 9B

Channuoivietnam.com © 2013 được phát triển bởi Viện Công Nghệ Sáng Tạo - Email: dohuuphuong2010@gmail.com - ĐT: 0908.255.265 Trang chủ